2.3.3 Theoretical Control

Prepare a sheet of paper. At the top, write your name. Then, write the following DNA sequence:

GACGTAGCCGTTACGATCGATCGGTCA

It contains 27 bases.

Problem 1: Write a table with the quantities of each nucleotides, A, C, T, G.

Problem 2: What is the GC-content of this sequence?

Problem 3: Write the RNA strand that is complementary to this one. For example, ACT will become TGU.

Problem 4: Translate the RNA strand into codons using the following table, for each of the three positions. That is, starting at the first base, at the second, and at the third. In order to read the table, you start on the first column, then the first line, then the last column. For example, UUU translates to F.

Problem 5: What are the open reading frames, that is, genes in potential, in this sequence?