2.3.1 Translating bases to codons

1 Codons

Codons are triples of bases. These are the units ribosomes use to translate between bases and aminoacids.

Many representations are possible to show the translation between codons and aminoacids.

2 Mapping codons

Translate into the corresponding aminoacids:

> s <- DNAString("ACTGAGACACTTGCG")
> Biostrings::translate(s)
5-letter AAString object
seq: TETLA

3 Genes

The molecular gene is a sequence of nucleotides in DNA that is transcribed to produce a functional RNA. Genes can lead to the production of sequences of aminoacids. That is, proteins. There are particular codons that can imply the start and the end of genes:

Genes start with ATG (Methionine).
Genes end with TAA (Ochre), TAG (Amber), TGA (Opal).

> start <- DNAString("ATG")
> end1 <- DNAString("TAA")
> end2 <- DNAString("TAG")
> end3 <- DNAString("TGA")

Apply the function Biostrings::translate to each one of these.

4 1, 2 and 3 reading frames

We can name sites as reading frames 1, 2 or 3 depending if their nucleotide has remainder 0, 1 or 2, respectively when divided by three. Start and end sites must be in the same reading frames.

By default, a sequence is in the reading frame 1. We can find the other reading frames by skipping the starting position:

> s[1:length(s)] # reading frame 1, same as s
> s[2:length(s)] # reading frame 2
> s[3:length(s)] # reading frame 3

5 Exercise: finding all possible codons

In the full sequence, genes don’t have to start at the beginning of the sequence. Therefore, there are three possible lists of codons.

> c1 <- Biostrings::translate(s[1:length(s)])
> c2 <- Biostrings::translate(s[2:length(s)])
> c3 <- Biostrings::translate(s[3:length(s)])

Look at these three sequences, and try to find genes. Remembering, it starts with M, and finishes with *.

6 Computationally find potential genes

Find the potential start and end codons in the sequence. (In 1, 2 or 3 position)
Match start codons to end codons. These end codons must be after the start codons, and there must a multiple of three bases between them.
Extract the obtained sequences between start and end.

7 Exercise 1: finding potential genes

Find the possible genes in this sequence:

ATGGGGCTCATTCAAGAAGAATGGAGTAACTAG

8 Exercise 2: finding potential genes